Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 54984205 54992495 enh75045

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 54988357 rs145296849 T TGCCTCCCGGTTCACATGATCCGCTCCGCTCA 2652822
chr12 54988357 rs55731980 T TGCCTCCCGGTTCACATGATCCGCTCCGCTCA 2652823

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results