| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr12 | 54984205 | 54992495 | enh75045 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr12 | 54988357 | rs145296849 | T | TGCCTCCCGGTTCACATGATCCGCTCCGCTCA | 2652822 | |
| chr12 | 54988357 | rs55731980 | T | TGCCTCCCGGTTCACATGATCCGCTCCGCTCA | 2652823 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|