Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 56037782 56046995 enh14750

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 56039133 rs372345499 CAACCACCAGAGGCAAGCTCCA C 2655718
chr12 56039133 rs373385312 CAACCACCAGAGGCAAGCTCCA C 2655719
chr12 56039149 rs36092717 G A 2655720

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results