Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 58956625 58962675 enh80210

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 58960099 rs535882404 TAGATAATGCATTTTGGGAAG T 2668528

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results