| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr12 | 63164414 | 63168626 | enh89661 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr12 | 63165304 | rs188744476 | C | T | 2681491 | |
| chr12 | 63165308 | rs149608735 | CCAAAAGTTCATGTAGCCCTTTCATATG | C | 2681492 | |
| chr12 | 63165308 | rs374637346 | CCAAAAGTTCATGTAGCCCTTTCATATG | C | 2681493 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|