Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 63164414 63168626 enh89661

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 63165304 rs188744476 C T 2681491
chr12 63165308 rs149608735 CCAAAAGTTCATGTAGCCCTTTCATATG C 2681492
chr12 63165308 rs374637346 CCAAAAGTTCATGTAGCCCTTTCATATG C 2681493

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results