Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 86359045 86363195 enh110881

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 86360566 rs11273999 AGTGTGTGTGTCTGTGGGGG A 4635266
chr16 86360566 rs72419608 AGTGTGTGTGTCTGTGGGGG A 4635267
chr16 86360583 rs185233528 G C 4635268

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results