Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 64320925 64327699 enh29641

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 64321593 rs540350718 TTTGAGGGAACTGGGAACCC T 2686166

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results