Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 64381305 64394035 enh29644

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 64386440 rs72350838 TACACACACACACACACACACACAC T 2686743
chr12 64386440 rs745757823 TACACACACACACACACACACACAC T 2686744

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results