Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 65098667 65102861 enh43755

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 65101316 rs371707573 ATGCTGGAGCATGCCTGTAGCATGCC A 2690638

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results