Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 66239258 66256635 enh75065

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 66245878 rs545366774 A AAATTTGTACAAAGTACAATTTGTGCAAAT 2696315

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results