Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 68969845 68988115 enh14808

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 68986728 rs543999833 GTATATATATAGATGTGTGTATATACA G 2712583

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results