EnhancerDB
  1. Home
  2. TFBS
  3. TFAP2A[chr16:87047198-87047203]
Chromosome characteristics of TFAP2A[chr16:87047198-87047203]
Back to top
Enhancers possibly regulated by TFAP2A[chr16:87047198-87047203]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 87016723 87048874 enh32010
Bone Marrow (K562) Epithelial (MCF-7) Prostate (RWPE1) Astrocyte Bone (Osteoblast) Lung (A549) Colon (HCT116) Muscle (Myotube) Heart
SNP sites on TFAP2A[chr16:87047198-87047203]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 87047200 rs372736619 GGGGAACGAAAGAGTGACTCTCACAT G 4645444
chr16 87047200 rs563988833 GGGGAACGAAAGAGTGACTCTCACAT G 4645445
Genes possibly regulated by TFAP2A[chr16:87047198-87047203]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TFAP2A[chr16:87047198-87047203]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results