Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 87204866 87215955 enh32016

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 87211525 rs533685364 TGGGAGGCTGGACAGAGGAGAGCGA T 4647357
chr16 87211531 rs73234057 G T 4647358

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results