Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 87309185 87314618 enh88266

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 87312529 rs181646082 C G,T 4648785
chr16 87312536 rs151241131 CTCGTGCTCGTAAGGAAAGCAGGGTGGGCTGG C 4648786

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results