Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 91328365 91334535 enh29850

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 91329105 rs114722529 C T 2793809
chr12 91329112 rs572582501 CAGCTCTTAAGCTGATAACATCAGATTA C 2793810

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results