Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 93826154 93833355 enh2509

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 93829673 rs142110545 ATTAATTAAATGTATTTTCTTAAGTAAATTT A 2812136

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results