Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 93876548 93880692 enh86137

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 93879758 rs112653536 TGTTTTTAAATTTTTTGTAGAGATGAG T 2812437

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results