Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 94444765 94459275 enh29878

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 94450977 rs374602379 A ATAATTAATTCACATATTTAATTATG 2817280

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results