Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 94592025 94602075 enh2514

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 94593230 rs563403642 GTGGGGAGCAAAGAGGAATATGTCC G 2818668
chr12 94593231 rs77106229 T G 2818669

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results