Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 97162145 97176315 enh80355

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 97162437 rs555564182 AAAAACAAAACAAAGCAAAATAAAAC A 2835182

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results