Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 98789225 98801915 enh29906

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 98799008 rs368887090 TGTTGACACATCCAGAAAACTGTGACTCGGAA T 2840682
chr12 98799008 rs72066347 TGTTGACACATCCAGAAAACTGTGACTCGGAA T 2840683

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results