EnhancerDB
  1. Home
  2. TFBS
  3. FOXB1[chr12:98799006-98799017]
Chromosome characteristics of FOXB1[chr12:98799006-98799017]
Back to top
Enhancers possibly regulated by FOXB1[chr12:98799006-98799017]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 98789225 98801915 enh29906
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Bone (Osteoblast) Muscle (A673) Colon (HCT116) Thyroid Peripheral Blood (MM.1S) Lung (PC-9) Muscle (Myotube) Blood (T-cell)
SNP sites on FOXB1[chr12:98799006-98799017]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 98799008 rs368887090 TGTTGACACATCCAGAAAACTGTGACTCGGAA T 2840682
chr12 98799008 rs72066347 TGTTGACACATCCAGAAAACTGTGACTCGGAA T 2840683
Genes possibly regulated by FOXB1[chr12:98799006-98799017]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOXB1[chr12:98799006-98799017]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results