Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 89480385 89484641 enh86227

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 89480427 rs559849414 ACCACGGGCCTGCACACCCTCCG A 4676294
chr16 89480432 rs561167662 G A 4676295

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results