Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 89713603 89717717 enh86228

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 89715563 rs546511808 TAACTCAACCTCCCCACCCCACGCTGATCCAG T 4679016
chr16 89715564 rs61482648 A C 4679017
chr16 89715565 rs58050886 A C 4679018

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results