Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 89713603 89717717 enh86228

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 89715594 rs200475208 G GCTT 4679020
chr16 89715614 rs565083538 ACGCTGATCCAGCTTCCCTCAACCTCCCCACCCCG A 4679021

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results