Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 113802546 113806855 enh64641

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 113804216 rs71447213 C CACAAAACTACAAAATGAAACTACAAAAAAAACT 2908912

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results