EnhancerDB
  1. Home
  2. TFBS
  3. ZIC1[chr7:582366-582380]
Chromosome characteristics of ZIC1[chr7:582366-582380]
Back to top
Enhancers possibly regulated by ZIC1[chr7:582366-582380]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 574701 595435 enh23907
Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Bone (Osteoblast) Placenta Colon (HCT116) Breast Lung (PC-9) Pancreas Pancreas (Panc1) Epithelial (MCF-7)
SNP sites on ZIC1[chr7:582366-582380]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 582379 rs573000126 GGATCAGTGGAACCCGACCCAGTGAC G 9563225
Genes possibly regulated by ZIC1[chr7:582366-582380]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZIC1[chr7:582366-582380]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results