Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 117560885 117576311 enh57626

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 117564483 rs553781870 A AGTAAGCATATCAGCATGTAATAGGCAT 2933375

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results