Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 673417 683605 enh23911

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 673658 rs551851877 ATAAATAAATTTTGTTTTTT A 9564426

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results