Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 121372125 121379595 enh15051

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 121376650 rs140202929 CAGGCATGGTGGTGCATGCCTAT C 2949190

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results