Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 935445 943335 enh94670

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 940257 rs199900149 G GGGGCAAAGAC,GGGGCAAAGGC,GGGGCAAAGGCGGGCAAAGGC,GGGGCAAAGGT,GGGGCAAAGGTGGGCACAGGCTT 9566825
chr7 940258 rs113839920 G GGGCAAAGGCA 9566826
chr7 940259 rs576648359 G GGCAAAGGCAA,GGCAAAGGCAGGCAAAGGCAA 9566827
chr7 940267 rs3824079 T A,C 9566828
chr7 940267 rs539485525 T TGGGCAAAGGC,TGGGCACAGGC 9566829

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results