Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 123513349 123517499 enh62318

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 123514535 rs138364638 A ACAGACACCCACAAAGAGGTGGAAGG,AGGTGGAAGG 2961528
chr12 123514535 rs377389301 A ACAGACACCCACAAAGAGGTGGAAGG 2961529

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results