| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr12 | 123513349 | 123517499 | enh62318 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr12 | 123514535 | rs138364638 | A | ACAGACACCCACAAAGAGGTGGAAGG,AGGTGGAAGG | 2961528 | |
| chr12 | 123514535 | rs377389301 | A | ACAGACACCCACAAAGAGGTGGAAGG | 2961529 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|