Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 124052957 124058346 enh86153

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 124057110 rs552770491 T TACCACCTTAGTTGCTGTCAATCAATGTGCC 2964054
chr12 124057112 rs11057298 C A 2964055

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results