EnhancerDB
  1. Home
  2. TFBS
  3. TFAP2C[chr12:124492023-124492038]
Chromosome characteristics of TFAP2C[chr12:124492023-124492038]
Back to top
Enhancers possibly regulated by TFAP2C[chr12:124492023-124492038]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 124488365 124494975 enh51435
Pancreas Blood (T-cell) Large Intestine
SNP sites on TFAP2C[chr12:124492023-124492038]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 124492026 rs373254353 CCCTGCAGCCACTGCCTTCG C 2965003
chr12 124492026 rs531675639 CCCTGCAGCCACTGCCTTCG C 2965004
chr12 124492030 rs111630369 G T 2965005
Genes possibly regulated by TFAP2C[chr12:124492023-124492038]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TFAP2C[chr12:124492023-124492038]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results