Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 124742345 124746495 enh90989

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 124745206 rs184382943 G A 2966861
chr12 124745208 rs375468970 AGGTTGCAGTGGGCCTGCGCCAC A 2966862

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results