Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 1058417 1062703 enh61447

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 1059761 rs142345702 CCAGGCCCAGCAGTGCATGGATGCGG C 9568436
chr7 1059769 rs563486942 A C 9568437

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr7 1062591 1062613 - hsa-miR-339-3p MIMAT0004702 1068004 0.710973 0.81487 8231 1407