| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr7 | 1063603 | 1075415 | enh102825 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr7 | 1070179 | rs535733446 | ACAGAGGGGGAACCAAGCCCAGCAAAGGTGGACACATAC | A | 9568650 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr7 | 1062591 | 1062613 | - | hsa-miR-339-3p | MIMAT0004702 | 1068004 | 0.710973 | 0.81487 | 2167 | 1407 |