Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 125285105 125290975 enh75190

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 125289652 rs375757133 CACCAAGACAAGAAGAGGAAGACAAGAAG C 2973812
chr12 125289652 rs72167165 CACCAAGACAAGAAGAGGAAGACAAGAAG C 2973813

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results