| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr12 | 125285105 | 125290975 | enh75190 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr12 | 125289652 | rs375757133 | CACCAAGACAAGAAGAGGAAGACAAGAAG | C | 2973812 | |
| chr12 | 125289652 | rs72167165 | CACCAAGACAAGAAGAGGAAGACAAGAAG | C | 2973813 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|