Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 1763076 1768235 enh66342

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 1767113 rs145204034 GTGCCCCTGTGGTCAGTCCTGGGC G 9575103
chr7 1767113 rs375335963 GTGCCCCTGTGGTCAGTCCTGGGC G 9575104

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results