Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 2088488 2094695 enh66343

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 2090880 rs562745631 GCCTGGGCACTGGAGGAGCCTC G 9578977

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results