Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 2101111 2114114 enh49206

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 2102478 rs532922698 GTGACCCACTCCCTGCACACAGCA G 9579118

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results