Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 3028745 3032895 enh97963

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 3030951 rs530244650 GATAAACAAATTGTGGTAATAAAA G 9588450

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results