EnhancerDB
  1. Home
  2. TFBS
  3. ZNF263[chr10:23807466-23807487]
Chromosome characteristics of ZNF263[chr10:23807466-23807487]
Back to top
Enhancers possibly regulated by ZNF263[chr10:23807466-23807487]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 23799365 23807715 enh13056
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Placenta Lung (PC-9) Epithelial (MCF-7)
SNP sites on ZNF263[chr10:23807466-23807487]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 23807468 rs537629249 TTTCCTATTTTCCTTCCTTCCTTCC T 1264782
chr10 23807468 rs555098694 T C 1264783
chr10 23807479 rs571992762 C G 1264784
chr10 23807485 rs12247906 T A,C 1264785
Genes possibly regulated by ZNF263[chr10:23807466-23807487]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF263[chr10:23807466-23807487]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results