Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 25981945 25986095 enh94087

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 25982816 rs145634223 AGTGTCTATTGTTGCCATCTTTAT A 1275073
chr10 25982816 rs869311551 AGTGTCTATTGTTGCCATCTTTAT A 1275074

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results