Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 26795045 26799195 enh111649

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 26797512 rs560525431 G GCTAAATCACATAACTGTGATTTAGCTTA 1277850

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results