Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 27933194 27937985 enh102408

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 27935765 rs138631090 CCAAGCACACACATTTTAACATTGTG C 1282582
chr10 27935765 rs143267921 CCAAGCACACACATTTTAACATTGTG C 1282583

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results