| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr10 | 30900685 | 30908315 | enh13114 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr10 | 30905793 | rs554582937 | AAATATACTTTTAATTTTTCTAGTAATTATTTACTTTT | A | 1307569 | |
| chr10 | 30905793 | rs56988568 | AAATATACTTTTAATTTTTCTAGTAATTATTTACTTTT | A | 1307570 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|