Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 33176845 33180995 enh96060

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 33177449 rs140808762 ATTGTTTAACAGTAATACTTT A 1321575

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results