Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 87686165 87690495 enh64355

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 87690066 rs541708204 CGGTTATTTATAACTACAAATAACTTGT C 1549977
chr10 87690066 rs61855979 C T 1549978

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results