EnhancerDB
  1. Home
  2. TFBS
  3. LMX1A[chr10:88733859-88733867]
Chromosome characteristics of LMX1A[chr10:88733859-88733867]
Back to top
Enhancers possibly regulated by LMX1A[chr10:88733859-88733867]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 88732445 88742955 enh43356
Prostate (PC-3) Cervix (HeLa-S3) Esophagus Bone (Osteoblast) Stomach Colon (HCT116) Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Heart
SNP sites on LMX1A[chr10:88733859-88733867]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 88733859 rs368648402 CTTAATTATAACTGTTAATTT C 1555668
chr10 88733859 rs541921896 CTTAATTATAACTGTTAATTT C 1555669
Genes possibly regulated by LMX1A[chr10:88733859-88733867]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by LMX1A[chr10:88733859-88733867]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results