Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 88812425 88816575 enh74641

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 88813192 rs548021272 A AACCACAAAGACCTGCTTTGTGTCCCTGT 1556015

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results