EnhancerDB
  1. Home
  2. TFBS
  3. POU4F2[chr10:89893774-89893790]
Chromosome characteristics of POU4F2[chr10:89893774-89893790]
Back to top
Enhancers possibly regulated by POU4F2[chr10:89893774-89893790]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 89889405 89893915 enh62074
Esophagus Stomach Thyroid Pancreas Uterus Epithelial (MCF-7)
SNP sites on POU4F2[chr10:89893774-89893790]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 89893780 rs36206424 TACATATTCATTC T 1560813
chr10 89893780 rs372644498 TACATATTCATTC T 1560814
chr10 89893780 rs538154553 TACATATTCATTCACATATTCATTC T 1560815
chr10 89893780 rs539061256 TACATATTCATTC T 1560816
Genes possibly regulated by POU4F2[chr10:89893774-89893790]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POU4F2[chr10:89893774-89893790]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results